The Boston Keratoprosthesis in Herpetic Keratitis

Some studies have sought to determine the prevalence of either acyclovir-resistant strains or clinical resistance ().13,15,19,71,79, D The mechanism of resistance in the majority of cases appears to be a mutation or deletion of the thymidine kinase gene, which may be difficult to interpret due to gene polymorphisms.36 It appears that antiviral resistance remains low in immunocompetent individuals, likely because the immune system drives the virus into a latent state, whereas resistance is much higher in the immunocompromised.4 This should be considered as a cause of treatment failure so that alternative treatments can be used, although cross-resistance may also occur.57 Studies have used varying methodologies in different clinical scenarios; therefore there is no clear indication at this time that long-term prophylactic antivirals in the form of nucleoside analogues should be avoided in the management of ocular herpes. Acute HSV epithelial keratitis usually resolves after 1-2 weeks. There is little tendency to ulcerate. The PCR mixture was as described above, except that 2 mM MgCl2 and 50 ng each of sense (5′CAGCGAGTACCAGTCCCTTTT3′) and antisense (5′CCTCGCTGCCTCCAAGA3′) MIP-1α primers (9) were used. Patients were excluded from the study if their ulcer had been present for more than 14 days or if they were younger than 12 years of age. The effects of the treatment and day were assessed individually using the nested effect rather than the overall error.

Briefly, wild-type mice between 8 and 9 weeks of age were infected intracorneally with 107 PFU of HSV-1F per eye and sacrificed 23 days p.i. Mice were infected via corneal scarification and inoculation of 2 × 106 PFU per eye. Although there was some variation in epithelial thickness over time, particularly at day 25 of culture (), no significant differences in epithelial thickness were noted, and the thickness averaged approximately 50 μm at all time points tested (). It is characterized by pain, usually redness and peripheral ulceration with corneal thinning. We next evaluated the antiviral efficacy of TCP on the virus whose replication cycle is not dependent on DNA. The currently recommended treatment involves standard induction dosages of ganciclovir or foscarnet, with adjunctive high-dose intravenous acyclovir (15 mg per kilogram every 8 hours).


Bowman’s membrane can become hazy, but the disease is still limited to the epithelium. Eyes of BALB/c treated were infected with 106 pfu of HSV-1, McKrae strain, and allowed to establish … Overall, these data suggest that MHCII-dependent antigen presentation and DC-autophagy contribute to the incidence of HSK. The MDS for conjunctivitis was at its maximum level at 11 and 18 days p.i. The usual animal models are the mouse and rabbit with the latter now rarely used except for studies on therapy. 21.

Although primary HSV infection in the region occur mainly during childhood, the majority of HSK cases are due to the recurrence of latent infections which aggravate the respective sufferer’s conditions at older age, as demonstrated in the current study. Evidence refuting corneal latency comes from studies which do not sufficiently demonstrate the absence of active infection, do not provide stable copy numbers of corneal HSV-1 DNA and RNA, or do not show reactivation with isolation of infectious HSV-1. Stromal opacification was rated on a scale of 0 to 4, where 0 indicates clear stroma, 1 indicates mild stromal opacification, 2 indicates moderate opacity with discernible iris features, 3 indicates dense opacity with loss of defined iris detail except pupil margins, and 4 indicates total opacity with no posterior view. (See above list.) What treatment has already been tried? Scale bar, 100 μm. When we showed clinical photographs to 14 ophthalmologists and asked for a diagnosis, we found little correlation (p=0.220) between the PCR results (positive or negative) and the ophthalmologists’ diagnosis.

Most acute episodes are managed by patching, and cycloplegic and topical antibiotic ointment, with prophylactic application of gels during daytime and ointment at night. Vernal ulcer is usually unilateral and involves the superior 1/3rd of the cornea. This gives rise to a dendritic ulcer. Canonically, the destructive inflammation characterizing HSK is regulated by CD4+ T cells (18,–21). Br J Ophthalmol 1982, 66: 643–7. 12: CD002898.

Consequently, HSV is a leading viral cause of sight-threatening disease in humans (34), and a vaccine that limits herpetic infection at ocular as well as other body sites is a highly desirable objective.